View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_72 (Length: 200)
Name: J5_4_72
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_4_72 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 39934111 - 39933912
Alignment:
| Q |
1 |
agatgatcaggtgtaggtgagtgtatgatgcacttgctgnnnnnnnnctttctttctcatccacaatatgagacctatatttatctcttccactatagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934111 |
agatgatcaggtgtaggtgagtgtatgatgcacttgctgttttttttctttctttctcatccacaatatgagacctatatttatctcttccactatagaa |
39934012 |
T |
|
| Q |
101 |
cccacccttgattgaagcataagtgaaacctattaaacttagccgtttagacccactatttatcttcctttttgtggatggcctcttgttgtttgcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934011 |
cccacccttgattgaagcataagtgaaacctattaaacttagtcgtttagacccactatttatcttcctttttgtggatggcctcttgttgtttgcttca |
39933912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10995 times since January 2019
Visitors: 8059