View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_8_1 (Length: 224)
Name: J5_8_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_8_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35916164 - 35916021
Alignment:
| Q |
1 |
gattgtgctggttttcttgaacaaactggaaggccagtccttccagctttagctcaggttagccttattgtctatgatgttttgncagtacatatggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35916164 |
gattgtgctggttttcttgaacaaactggaaggccagtccttccagctttagctcaggttagccttattgtctatgatgttttgtcagtacatatggata |
35916065 |
T |
|
| Q |
101 |
aagtgatcaagaaaaaacctaaactaagttaagccgacattaat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916064 |
aagtgatcaagaaaaaacctaaactaagttaagccgacattaat |
35916021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 139 - 224
Target Start/End: Complemental strand, 35916245 - 35916160
Alignment:
| Q |
139 |
attaatgttgttgaangatacagaattggcgttgatggatggatgcgtgttccatctgtggaagatgtctttgcacttggggattg |
224 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916245 |
attaatgttgttgaatgatacagaattggcgttgatggatggatgcgtgttccatctgtggaagatgtctttgcacttggggattg |
35916160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13724 times since January 2019
Visitors: 8302