View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_8_19 (Length: 206)
Name: J5_8_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_8_19 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 219370 - 219475
Alignment:
| Q |
19 |
attaaaaaattccagatgagatatgaatgatttgtgaaatcatatgatcttttatcttagttcttctccccctattatattttgtggtttagttgtggta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219370 |
attaaaaaattccagatgagatatgaatgatttgtgaaatcatatgatcttttatcttagttcttctccccctattatattttgtggtttagttgtggta |
219469 |
T |
|
| Q |
119 |
attaat |
124 |
Q |
| |
|
|||||| |
|
|
| T |
219470 |
attaat |
219475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 118 - 206
Target Start/End: Original strand, 219268 - 219356
Alignment:
| Q |
118 |
aattaattagtacatacttcattacatgttcctctctcctcataaaaattcaatgaaaagatgataaatttaaacatttatataaatag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219268 |
aattaattagtacatacttcattacatgttcctctctcctcataaaaattcaatgaaaagatgataaatttaaacatttatataaatag |
219356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16490 times since January 2019
Visitors: 3768