View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_8_7 (Length: 238)
Name: J5_8_7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_8_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 35986290 - 35986359
Alignment:
| Q |
1 |
cacttcactagaagaaaatagaagtgtctagtatctattttatgtttctttttcgtagtaaaaattatta |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35986290 |
cacttcactagaagaaaatagaagtgtctagtatatattttatgtttctttttcgtagtaaaaattatta |
35986359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 35986135 - 35986181
Alignment:
| Q |
132 |
aaattaattcntcatattttgcgggattcaaatnaacggaancaaat |
178 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
35986135 |
aaattaattcttcatattttgtgggattcaaataaacggaatcaaat |
35986181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 228
Target Start/End: Original strand, 35986253 - 35986285
Alignment:
| Q |
196 |
aagaaaaaaccacttttttagcaatctaaattc |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
35986253 |
aagaaaaaaccacttttttagcaatccaaattc |
35986285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12894 times since January 2019
Visitors: 8269