View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095-INSERTION-3 (Length: 298)
Name: NF0095-INSERTION-3
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095-INSERTION-3 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 28957640 - 28957795
Alignment:
Q |
1 |
acttatgattattttcaaccagagattaaacttgagtactcttga-ttacaagattttaactgatgtatccttnnnnnnnnnnnngattttaactgatgt |
99 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||||| | |
|
|
T |
28957640 |
acttatgattattttcaaccaaagattaaacttgagtactcttgatttacaagattttaacttatgtatcctt-aaaaaaaaaaagattttaactgatat |
28957738 |
T |
|
Q |
100 |
tcaaagttcaattagcaaacnnnnnnnaaaagcaacaaagataacatttattgaagg |
156 |
Q |
|
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
28957739 |
tcaaagttcaattagcaaactttttttaaaagcaacaaaaataacatttattgaagg |
28957795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 28957854 - 28957936
Alignment:
Q |
214 |
gatgggagaactgttaacacaaatcaaaaagcgcctctaatatgaaggtaaattctaaggtgccctcaagtttagaagggatt |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
28957854 |
gatgggagaactgttaacacaaatcaaaaagcgcttctaatatgaaggtaaattcaaaggtgccctcaagtttcgaagggatt |
28957936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9866 times since January 2019
Visitors: 7932