View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_25 (Length: 370)
Name: NF0095_high_25
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_25 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 43 - 370
Target Start/End: Original strand, 19755198 - 19755525
Alignment:
Q |
43 |
catcatcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttc |
142 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
19755198 |
catcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggacccccttcattttcttcatcaatgtgttgttgatcatcttc |
19755297 |
T |
|
Q |
143 |
aacacttttagcattcaaatcttgaggaggagcagagagcattttctctcggtcttcatcatctttgggaggactagagtcaactatcatattgtcctca |
242 |
Q |
|
|
|||||||||| ||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
19755298 |
aacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctttgggaggactagagtcaattatcatattgtcctca |
19755397 |
T |
|
Q |
243 |
aagatggggtcaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaactttagcacccttaaacacataaaaaagtc |
342 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
T |
19755398 |
aagatggggttaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaacttcagcaccctgaaacacattaaaaagtc |
19755497 |
T |
|
Q |
343 |
gaagtaaataaagaaggcttgttaaaga |
370 |
Q |
|
|
||||| ||||||||||| |||||||||| |
|
|
T |
19755498 |
gaagttaataaagaaggtttgttaaaga |
19755525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7741 times since January 2019
Visitors: 7737