View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_33 (Length: 321)
Name: NF0095_high_33
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_33 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 39825728 - 39825885
Alignment:
Q |
1 |
agattgcacacagttcaaatcctattcgcaatagtcttttgataaatggtccatgaaaacaagttggataacaacataattgttttttatgttgtcgtaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39825728 |
agattgcacacagttcaaatcctattcgcaatagtcttttgataaatggtccatgacaacaagttggataacaacataattgttttttatgttgtcgtaa |
39825827 |
T |
|
Q |
101 |
ccacaactcttgcaattgaggatgcatcgtcaacatttgatcaagggaacagttactc |
158 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
39825828 |
ccacaactcttgcaattgaggatgcatcgtcaacatttgatcacgggaacagttactc |
39825885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39922125 - 39922179
Alignment:
Q |
238 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39922125 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
39922179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39825963 - 39826017
Alignment:
Q |
238 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39825963 |
tcttttgcattcaatctatatggcagggatccatgatgacaccccatgtaaatcc |
39826017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39902524 - 39902578
Alignment:
Q |
238 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39902524 |
tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc |
39902578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39910982 - 39911036
Alignment:
Q |
238 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39910982 |
tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc |
39911036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39927821 - 39927875
Alignment:
Q |
238 |
tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39927821 |
tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc |
39927875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 254 - 292
Target Start/End: Original strand, 39805615 - 39805653
Alignment:
Q |
254 |
tatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39805615 |
tatatggcagggatccatgatgacaccccatgtaaatcc |
39805653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 250 - 292
Target Start/End: Original strand, 39814896 - 39814938
Alignment:
Q |
250 |
aatctatatggcagggatccatgatgacaccccatgtaaatcc |
292 |
Q |
|
|
||||||| || |||||||||||||||||||||||||||||||| |
|
|
T |
39814896 |
aatctatgtgacagggatccatgatgacaccccatgtaaatcc |
39814938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 104
Target Start/End: Original strand, 39902359 - 39902401
Alignment:
Q |
62 |
agttggataacaacataattgttttttatgttgtcgtaaccac |
104 |
Q |
|
|
||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
T |
39902359 |
agttggatagcaaaataattgtttttgatgttgtcgtaaccac |
39902401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 39910683 - 39910764
Alignment:
Q |
14 |
ttcaaatcctattcgcaatagtcttttgataaatggtccatgaaaacaagttggataacaacataattgttttttatgttgtc |
96 |
Q |
|
|
||||||||| |||| ||||| ||||| ||| ||| ||| ||| ||| ||||||||| |||||||||||||||| |||||||| |
|
|
T |
39910683 |
ttcaaatccaattcacaatattctttcaatagatg-tccttgacaacgagttggatatcaacataattgtttttgatgttgtc |
39910764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11334 times since January 2019
Visitors: 8091