View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_14 (Length: 486)
Name: NF0095_low_14
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_14 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 4e-70; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 22 - 172
Target Start/End: Complemental strand, 28825932 - 28825782
Alignment:
Q |
22 |
gttgaataacatgtgagtggcacgtgactggtcaattgttttaatataaagtcaatgatcagcaaaagatgtggggatcttggacttggggcatgcgttg |
121 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
28825932 |
gttgaatagcatgtgagtggcacgtgactggtcaattgttttaatataaagtcaatgatcagcaaaagaggtggggatcttggacttggggcatgcgttg |
28825833 |
T |
|
Q |
122 |
ttactttagaatctcaatttcaattttaattattttaatgatacatgtcac |
172 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
T |
28825832 |
ttactttagaatctcaatttcatttttaattattttaatgaaacatgtcac |
28825782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 329 - 391
Target Start/End: Complemental strand, 28825697 - 28825635
Alignment:
Q |
329 |
caagaatgagggagagccataaaattttattttaattttatacgaagcaagagccataatact |
391 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
T |
28825697 |
caagaaagagggagagccataaaattttattttaattttatacaaagcaagagccttaatact |
28825635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 290 - 327
Target Start/End: Complemental strand, 4614375 - 4614338
Alignment:
Q |
290 |
cattgattaagaaatcaaatgtagtaaatattacatta |
327 |
Q |
|
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
T |
4614375 |
cattgattaagaaagcaaatgtagtaagtattacatta |
4614338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 328
Target Start/End: Complemental strand, 28957832 - 28957774
Alignment:
Q |
270 |
gttaattgatgtttatggaacattgattaagaaatcaaatgtagtaaatattacattaa |
328 |
Q |
|
|
|||||| ||||||||||||||| |||||||| ||| |||| || ||||||||||||||| |
|
|
T |
28957832 |
gttaatcgatgtttatggaacactgattaaggaattaaatataataaatattacattaa |
28957774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8680 times since January 2019
Visitors: 7803