View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_50 (Length: 308)
Name: NF0095_low_50
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_50 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 38816379 - 38816155
Alignment:
Q |
1 |
ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38816379 |
ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt |
38816280 |
T |
|
Q |
101 |
ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38816279 |
ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact |
38816180 |
T |
|
Q |
201 |
gagttatgataattgtgcatgtgat |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
38816179 |
gagttatgataattgtgcatgtgat |
38816155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12257 times since January 2019
Visitors: 8179