View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_57 (Length: 285)
Name: NF0095_low_57
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_57 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 89 - 285
Target Start/End: Complemental strand, 41140451 - 41140255
Alignment:
Q |
89 |
gctttttgattagctgagtcatgctaataagcaaccaattatgtgtttatgttcctcgtcagctcccatgtcttggttcccaaatgcttgcgtggagtgg |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41140451 |
gctttttgattagctgagtcatgctaataagcaaccaattatgtgtttatgttcctcgtcagctcccatgtcttggttcccaaatgcttgcgtggagtgg |
41140352 |
T |
|
Q |
189 |
ggctataaatccatgcccattcaactaaacccacttatttttaattttataacaatatttaccatttcttttttggatcacattaaaaccaaaatac |
285 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
41140351 |
ggctataaatccatgcccattcaactaaacccacttatttttaattttataacaatatttaccatttcttttttggatcccattaaaaccaaaatac |
41140255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9855 times since January 2019
Visitors: 7932