View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_61 (Length: 270)
Name: NF0095_low_61
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_61 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 34524333 - 34524556
Alignment:
Q |
30 |
gatgttagatcccacaagttggatctcaaatgaaccaa-----gttcaagtcaatcaacaaaagcatcgcaattggacaattggtgtaattgttgttcat |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
34524333 |
gatgttagatcccacaagttggatctcaaatgaaccaaaccaagttcaagtcaatcaacaaaagcatcgcaattggacaattggtgt---------tcat |
34524423 |
T |
|
Q |
125 |
cgtttccctaaccatgcacattcctacttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct |
224 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34524424 |
cgtttccctaaccatgcacattcctacttggttaggagagttttctcttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct |
34524523 |
T |
|
Q |
225 |
atttcaataccattccaccgttgtagagcctct |
257 |
Q |
|
|
||||||||| ||||||||||||||||||||||| |
|
|
T |
34524524 |
atttcaatatcattccaccgttgtagagcctct |
34524556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 230
Target Start/End: Original strand, 1734611 - 1734689
Alignment:
Q |
152 |
ttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatctatttca |
230 |
Q |
|
|
|||||||||||| |||||| | |||| ||||||| ||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
T |
1734611 |
ttggttaggagagttttctctctggttatgagcataatgctctgttgaggagttcttgaactatggtttatctctttca |
1734689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12035 times since January 2019
Visitors: 8179