View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_69 (Length: 262)
Name: NF0095_low_69
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_69 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 233
Target Start/End: Complemental strand, 37138506 - 37138310
Alignment:
Q |
37 |
cattataagatgctaaacaagtagaaatcagcaaacttgatttaatatgtttcgaaacataagaacacatgaaactaaaaataaagcacacttgtatcca |
136 |
Q |
|
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
37138506 |
cattatacgatgctaaacaagtagaaataagcaaacttgatttaatatgtttcgaaacataagaacacatgagactaaaaataaagcacacttgtatcca |
37138407 |
T |
|
Q |
137 |
aaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatccaacccatatg |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37138406 |
aaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatccaacccatatg |
37138310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9034 times since January 2019
Visitors: 7893