View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_69 (Length: 262)

Name: NF0095_low_69
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_69
NF0095_low_69
[»] chr2 (1 HSPs)
chr2 (37-233)||(37138310-37138506)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 233
Target Start/End: Complemental strand, 37138506 - 37138310
Alignment:
37 cattataagatgctaaacaagtagaaatcagcaaacttgatttaatatgtttcgaaacataagaacacatgaaactaaaaataaagcacacttgtatcca 136  Q
    ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
37138506 cattatacgatgctaaacaagtagaaataagcaaacttgatttaatatgtttcgaaacataagaacacatgagactaaaaataaagcacacttgtatcca 37138407  T
137 aaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatccaacccatatg 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37138406 aaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatccaacccatatg 37138310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9034 times since January 2019
Visitors: 7893