View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_70 (Length: 262)
Name: NF0095_low_70
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_70 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 999153 - 998921
Alignment:
Q |
30 |
gaaattgctagacatatctagtatttctggtagatctctatgttattttcttcacaatgtttgattctggttacaagtcacagtatattgaaggtcggaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
999153 |
gaaattgctagacatatctagtatttctggtagatctctatgttattttcttcacaatgtttgattctggttacaagtcacagtatattgaaggtcagaa |
999054 |
T |
|
Q |
130 |
ggagaaatttgtgaggtatttttctttttggatataacatatcaatgtgattggttannnnnnnattcttttcttatctcaactctccggttctcgaggg |
229 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
999053 |
ggagaaatttgtgaggtatttttatttttggatataacatatcaatgtgattggttatttttttattcttttcttatctcaactctccggttctcgaggg |
998954 |
T |
|
Q |
230 |
aaagggactctattaacataagcatctttcaga |
262 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
998953 |
aaagggactctattaacataagcatctttcaga |
998921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16257 times since January 2019
Visitors: 3768