View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_71 (Length: 261)
Name: NF0095_low_71
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_low_71 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 354767 - 354574
Alignment:
Q |
1 |
tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
354767 |
tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg |
354668 |
T |
|
Q |
101 |
gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
354667 |
gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga |
354574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9256 times since January 2019
Visitors: 7893