View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_72 (Length: 252)
Name: NF0095_low_72
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_low_72 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 28 - 252
Target Start/End: Complemental strand, 3309161 - 3308930
Alignment:
| Q |
28 |
cataacaatacttttaagacgcgacagttccagcaccaacagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt------ |
121 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3309161 |
cataacaaaacttttaagacgcgacaattccagaaccaacagctgccaagtcaacaggtgcaattccatgcacattcaaacaaactttcactttcacttt |
3309062 |
T |
|
| Q |
122 |
tgactttaagctttgtttaacatcattaacgtgctaatacatatacagaaaatatatcaattaagatgattgttaat-gtcagagataaatgatagatac |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3309061 |
tgactttaagctttgtttaacatcgttaacgtgctaatacatatatagaaaatatatcaattgagatgattgttaatcgtcagagataaatgatagatac |
3308962 |
T |
|
| Q |
221 |
cagatactaaagttgtttaatttgtgatttat |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
3308961 |
cagatactaaagttgtttaatctgtgatttat |
3308930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 66 - 121
Target Start/End: Original strand, 3227787 - 3227842
Alignment:
| Q |
66 |
acagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3227787 |
acagttgccaagtcaacagatgcaattccatgcacattcaaacgaactttcacttt |
3227842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12966 times since January 2019
Visitors: 8270