View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_81 (Length: 205)
Name: NF0095_low_81
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 2622422 - 2622319
Alignment:
| Q |
1 |
aggatacggaaatatggtgacatatcat---aatattaagatcagaatagaagtcacacaacataaagatagggaaactatatatgtgattaatgaacag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2622422 |
aggatacggaaatatggtgacatatcatcataatattaaggtcagaatagaagtcacacaacataaagatagggcaactatatatgtgattaatgaacag |
2622323 |
T |
|
| Q |
98 |
atac |
101 |
Q |
| |
|
|||| |
|
|
| T |
2622322 |
atac |
2622319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9585 times since January 2019
Visitors: 7931