View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0110-INSERTION-9 (Length: 100)
Name: NF0110-INSERTION-9
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0110-INSERTION-9 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 50407505 - 50407419
Alignment:
Q |
8 |
gaaggttgcacaaattctccggtagatgagtgtgagttttaccccctcccatacgaggttccacactggaccaacaatgataatatt |
94 |
Q |
|
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
50407505 |
gaaggttgcacaacttctcctgtagatgagtgtgagttttaccccctcccatacgaggtttcacactggaccaacaatgataatatt |
50407419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11646 times since January 2019
Visitors: 8091