View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225-INSERTION-1 (Length: 291)
Name: NF0225-INSERTION-1
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0225-INSERTION-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 47 - 203
Target Start/End: Original strand, 2675982 - 2676137
Alignment:
| Q |
47 |
taactggaggtgtcttctaatgttagaagaaacctccagtttactctaaaacaaaaagaatatatgaatttttattcacttttttatctattagttttct |
146 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
2675982 |
taacaggaggtttcttcgaatgttagaagaaaccttcagtttactctaaaacaaaaaaaatatatggatttttatttactttt-tatctattagttttct |
2676080 |
T |
|
| Q |
147 |
aatcaatcttaagttggatttgtcttttaatttagaaataaaaaattaccgatgtgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2676081 |
aatcaatcttaagttggatttgtcttttaatttagaaataaaaaattaccgatgtgg |
2676137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 2676344 - 2676381
Alignment:
| Q |
240 |
gatttccaaggacaggggtttgttaacccaggttcaga |
277 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2676344 |
gatttccaaggacaggagtttgttaacccaggttcaga |
2676381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15893 times since January 2019
Visitors: 3757