View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225-INSERTION-4 (Length: 130)
Name: NF0225-INSERTION-4
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225-INSERTION-4 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 6039679 - 6039556
Alignment:
Q |
8 |
caatctactagaattttatcgttcaagacaatagaagtagatgaatttggatagagtaacaa-aaaagaagaagatgaatttggatagaggtgaacaaat |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
T |
6039679 |
caatctactagaattttatcgttcaagacaatagaagtagatgaatttggatagagtaacaaaaaaaaaagaagatgaatttggatagaggtgaacaaat |
6039580 |
T |
|
Q |
107 |
aaatttgtttgccgccccctaatt |
130 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
6039579 |
aaatttgtttgccgccccctaatt |
6039556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13328 times since January 2019
Visitors: 8301