View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_high_12 (Length: 393)
Name: NF0225_high_12
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_high_12 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 298 - 382
Target Start/End: Complemental strand, 29603251 - 29603167
Alignment:
Q |
298 |
acacattcaatcaaataagataaatgaagaaagtgttagattctaagctggactaaggttcaaacccagactcctttatttatga |
382 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| || || ||||||| |||||||||| ||||||| || ||||||||| |
|
|
T |
29603251 |
acacattcaatcaaataagataaatgaagaaagtgttaggttgtacgctggaccaaggttcaaatccagactactctatttatga |
29603167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 113 - 197
Target Start/End: Complemental strand, 29603251 - 29603167
Alignment:
Q |
113 |
acacattcaatcaaataagataaatgaagaaagtgttagattctaagctggactaaggttcaaacccagactcctttatttatga |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| || || ||||||| |||||||||| ||||||| || ||||||||| |
|
|
T |
29603251 |
acacattcaatcaaataagataaatgaagaaagtgttaggttgtacgctggaccaaggttcaaatccagactactctatttatga |
29603167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11037 times since January 2019
Visitors: 8059