View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_high_38 (Length: 251)
Name: NF0225_high_38
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_high_38 |
| |
|
[»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 34647215 - 34646993
Alignment:
Q |
29 |
acttgataagttacctaacccaagagttgaatatgccattggtagctgcttcaaatacactcacaaactttggtggaacatctagcttcacccctcttat |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34647215 |
acttgataagttacctaacccaagagttgaatatgccattggtagctgcttcaaatacactcacaaactttggtggaacatctagcttcacccctcttat |
34647116 |
T |
|
Q |
129 |
tggggctctacttgcagactcatttgctggaagattttggaccatcactgttggatgcctcatctatgaactggtttcttaacctctctctcatatttta |
228 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34647115 |
tggggctttacttgcagactcatttgctggaagattttggaccatcactgttggatgcctcatctatgaactggtttcttaacctctctctcatatttta |
34647016 |
T |
|
Q |
229 |
aatttttctttagtttacttact |
251 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
34647015 |
aatttttctttagtttacttact |
34646993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 29 - 158
Target Start/End: Complemental strand, 34661380 - 34661251
Alignment:
Q |
29 |
acttgataagttacctaacccaagagttgaatatgccattggtagctgcttcaaatacactcacaaactttggtggaacatctagcttcacccctcttat |
128 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||| | ||| |||| |||||||||| ||||||||||||| |||||||||| ||||| || |
|
|
T |
34661380 |
acttgataagttacctaactcaagagttgaatatgccattggtatcagctgcaaacacactcacaatctttggtggaacagctagcttcacacctctcat |
34661281 |
T |
|
Q |
129 |
tggggctctacttgcagactcatttgctgg |
158 |
Q |
|
|
||| ||||| || |||| || |||||||| |
|
|
T |
34661280 |
tggtgctctcatttcagagtcctttgctgg |
34661251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8484 times since January 2019
Visitors: 7803