View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0225_high_50 (Length: 215)

Name: NF0225_high_50
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0225_high_50
NF0225_high_50
[»] chr1 (1 HSPs)
chr1 (1-60)||(47552330-47552389)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 47552389 - 47552330
Alignment:
1 ttgtacaacgcacaactcatatataacagcacgtgccttactattaaatcacacagattc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47552389 ttgtacaacgcacaactcatatataacagcacgtgccttactattaaatcacacagattc 47552330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 12561 times since January 2019
Visitors: 8222