View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_10 (Length: 438)
Name: NF0225_low_10
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0225_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 9e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 338 - 420
Target Start/End: Complemental strand, 47552473 - 47552391
Alignment:
| Q |
338 |
gagtcatcagtcaatgacatccaacgcactaacgcatattttttctgttcataagaagaagaaaaaactcttatatttttgtt |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47552473 |
gagtcatcagtcaatgacatccaacgcactaacgcatattttttctgttcataagaagaagataaaactcttatatttttgtt |
47552391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11404 times since January 2019
Visitors: 8091