View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_21 (Length: 346)
Name: NF0225_low_21
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_21 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 49944776 - 49944474
Alignment:
Q |
16 |
actaataaagaatcacgcttttctcctttcttcactccattgtggaaagaagggannnnnnngatgagggtatgtgtttacactgttgttatctctggtt |
115 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
49944776 |
actaatgaagaatcacgcttttctcctttcttcactccattgtggaaagaagggatttttttgatgagggtatgtgtttacactgttgttatctctggtt |
49944677 |
T |
|
Q |
116 |
tgtgtctgttggtttggtttggaagtaataaagttaaggattatgtcgaagccaaactattgccttctgtttgtttggtaatcagcgagcagattcagcg |
215 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49944676 |
tgtgtctgttggtttggtttggaagtaatatagttaaggattatgtcgaagccaaactattgccttctgtttgtttggtaatcagcgagcagattcagcg |
49944577 |
T |
|
Q |
216 |
tgattttcagtttggaaaggttagaagaatctctccattgagtttgacattggagtcatgttcatttgggccacataaggaggaattttcttgtggtgag |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49944576 |
tgattttcagtttggaaaggttagaagaatctctccattgagtttgacattggagtcatgttcatttgggccacataaggaggaattttcttgtggtgag |
49944477 |
T |
|
Q |
316 |
gtt |
318 |
Q |
|
|
||| |
|
|
T |
49944476 |
gtt |
49944474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12025 times since January 2019
Visitors: 8179