View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_33 (Length: 287)
Name: NF0225_low_33
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_33 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 53 - 259
Target Start/End: Original strand, 885188 - 885396
Alignment:
Q |
53 |
agattgtgcatttgttactaatggtatagttggttggatactatatagatatcaacttcctctatcaaaacacgaatttgatatccatactatctcttga |
152 |
Q |
|
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
885188 |
agattatgcatttgttacaaatggtatagttggttggatactatatagatatcaacttcctctatcaaaacacgaatttgatatccatactatctcttga |
885287 |
T |
|
Q |
153 |
attgattgtggcatgagtattttattacataagtgaagcattgatattttacag--caagcaaatggttgataatttgtttatttgtccatcatcctctt |
250 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
885288 |
attgattgtggcatgagtattttattacataagtgaagcattgatattttacagcacaagcaactggttgataatttgtttatttgtccatcatcctctt |
885387 |
T |
|
Q |
251 |
gaaaatgag |
259 |
Q |
|
|
||||||||| |
|
|
T |
885388 |
gaaaatgag |
885396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14925 times since January 2019
Visitors: 8422