View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_49 (Length: 251)
Name: NF0225_low_49
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_49 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 5697798 - 5698040
Alignment:
Q |
1 |
ttttgacatcacccaattaatttatgtctcttgtgtacatatgaaaatagtactaacttctagtttcaaatttctcaaataatttatggacttttacagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5697798 |
ttttgacatcacccaattaatttatgtctcttgtgtacatatgaaaatagtactaacttctagtttcaaatttctcaaataatttatggacttttacagc |
5697897 |
T |
|
Q |
101 |
ctgacataacagctcctggagtagacatattggcagcctggacagctaaagatggacctacacgaatgaattttcgcgataaacgagttgttaagttcaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5697898 |
ctgacataacagctcctggagtagacatattggcagcctggacagctaaagatggacctacacgaatgaattttcgcgataaacgagttgttaagttcaa |
5697997 |
T |
|
Q |
201 |
tatcatttcaggaacttcaatgtcttgccctcatgtctctgct |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
5697998 |
tatcatttcaggaacttcaatgtcttgccctcatgtttctgct |
5698040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 87 - 243
Target Start/End: Original strand, 5685645 - 5685801
Alignment:
Q |
87 |
tggacttttacagcctgacataacagctcctggagtagacatattggcagcctggacagctaaagatggacctacacgaatgaattttcgcgataaacga |
186 |
Q |
|
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| |||| ||||||||| |
|
|
T |
5685645 |
tggacattttcagcctgacataacagctcctggagtagacatattggcagcatggacagctaaagacggccctacacgaatgacatttcaggataaacga |
5685744 |
T |
|
Q |
187 |
gttgttaagttcaatatcatttcaggaacttcaatgtcttgccctcatgtctctgct |
243 |
Q |
|
|
||||| |||| ||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
T |
5685745 |
gttgtaaagtacaatatcttttcaggaacttcaatgtcttgccctcatgtttctgct |
5685801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12933 times since January 2019
Visitors: 8269