View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_58 (Length: 215)
Name: NF0225_low_58
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_58 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 47552365 - 47552473
Alignment:
Q |
1 |
tatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttttcttcttcttatgaacagaaaaaatatgcgttagtgcgttggatgtcattgac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47552365 |
tatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttatcttcttcttatgaacagaaaaaatatgcgttagtgcgttggatgtcattgac |
47552464 |
T |
|
Q |
101 |
tgatgactc |
109 |
Q |
|
|
||||||||| |
|
|
T |
47552465 |
tgatgactc |
47552473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8415 times since January 2019
Visitors: 7802