View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304-INSERTION-4 (Length: 102)
Name: NF0304-INSERTION-4
Description: NF0304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304-INSERTION-4 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 2e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 2e-32
Query Start/End: Original strand, 11 - 102
Target Start/End: Complemental strand, 33446577 - 33446486
Alignment:
Q |
11 |
atcatatcctcygaaaaacctcctgatagacaacattgacagttgatgatgacgcctgtccgttttcatctgtgatcaaaatcttcaatcca |
102 |
Q |
|
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||| |||||||| || ||||||||||||||||||||| |
|
|
T |
33446577 |
atcatatcctctgaaaaacctcctcatagacaacattgacagttgatgatgacccctgaccgttttcgtccgtgatcaaaatcttcaatcca |
33446486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19229 times since January 2019
Visitors: 3808