View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_low_16 (Length: 271)
Name: NF0304_low_16
Description: NF0304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304_low_16 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 54119158 - 54119390
Alignment:
Q |
1 |
ttcacatcacacctcctaatgtgttgagctgatcttgccaaccattgaaaagaggccacattgatcgactcttccgctggtagattcagatccagaagag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
54119158 |
ttcacatcacacctcctaatgtgttgagctgatcttgccaaccattgaaaagaggccacattgatcgactcttccactggtagattcagatccggaagag |
54119257 |
T |
|
Q |
101 |
ctactggaccattattgttgatattttggccccatgcagtagaagagaatcccacataaaatgacgttgtttgatgaacaacacccttgcctttatgcat |
200 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54119258 |
ctattggaccattattgttgatattttggccccatgcagtagaagagaatcccacataaaatgacgttgtttgatgaacaacacccttgcctttatgcat |
54119357 |
T |
|
Q |
201 |
ttgggaagacccataattccgattctgatgatg |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
54119358 |
ttgggaagacccataattccgattctgatgatg |
54119390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17577 times since January 2019
Visitors: 3781