View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0311-INSERTION-3 (Length: 363)

Name: NF0311-INSERTION-3
Description: NF0311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0311-INSERTION-3
NF0311-INSERTION-3
[»] chr8 (1 HSPs)
chr8 (1-85)||(7509098-7509182)
[»] chr3 (2 HSPs)
chr3 (19-70)||(27241507-27241558)
chr3 (5-70)||(27249113-27249177)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 7509098 - 7509182
Alignment:
1 ttgtcaaactcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggaggcaccttgcttca 85  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7509098 ttgtcaacctcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca 7509182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 27241558 - 27241507
Alignment:
19 ggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatgg 70  Q
    ||||||||||||||||||||||| |||||||||||||||||||| |||||||    
27241558 ggtaaatcaaatttcttcctctcaccattttgaattgcattaagaagaatgg 27241507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 70
Target Start/End: Complemental strand, 27249177 - 27249113
Alignment:
5 caaactcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatgg 70  Q
    ||||||||| ||| ||| |||| |||||||||||||| |||||||||||||||||||| |||||||    
27249177 caaactctt-cttgggttaatcgaatttcttcctctcgccattttgaattgcattaagaagaatgg 27249113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 7756 times since January 2019
Visitors: 7737