View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-1 (Length: 50)
Name: NF0440-3-1-Insertion-1
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-1 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 43068883 - 43068838
Alignment:
Q |
5 |
tgatgatgatgaagatgacaaactagaagttgaagaggatacttct |
50 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
43068883 |
tgatgatgatgaagatgacaaactagaagttgaagaggatgcttct |
43068838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 32468 times since January 2019
Visitors: 7015