View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-12 (Length: 131)
Name: NF0440-3-1-Insertion-12
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-12 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 5e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 5e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 53007193 - 53007063
Alignment:
Q |
1 |
tctcgtgtatgaggtgttggaaatgatttttattccaaaaggatgaattggaagcataaatctttagtttatccggaaattgttagttcccatatgaact |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
53007193 |
tctcgtgtatgaggtgttggaaatgatttttattccaaaaggatgaattggaagcataaatctttagtttatccgaaaattgttagttcccatatgaact |
53007094 |
T |
|
Q |
101 |
ccaacaatcatgaacaaaatcacaaaaatca |
131 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
53007093 |
ccaacaatcatgaacaaaatcacaaaaatca |
53007063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11498 times since January 2019
Visitors: 6876