View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-13 (Length: 124)
Name: NF0440-3-1-Insertion-13
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-13 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 6004337 - 6004458
Alignment:
Q |
1 |
cacataaaagtaatgcttttgtcttgtcacaaaaacatataatgcatttttatatcgagtccatcaatttatgttctatggaataaaaagataacaaaag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6004337 |
cacataaaagtaatgcttttgtcttgtcacaaaaacatataatgcatttttatatcgagtccatcaatttatgttctatggaataaaaagataacaaaag |
6004436 |
T |
|
Q |
101 |
agaactacaagaaccatccgtc |
122 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
6004437 |
agaactacaagaaccatccgtc |
6004458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 36217 times since January 2019
Visitors: 7116