View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-14 (Length: 113)
Name: NF0440-3-1-Insertion-14
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-14 |
| |
|
[»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 36 - 113
Target Start/End: Complemental strand, 49201453 - 49201376
Alignment:
Q |
36 |
agttcttacttctatttcacataccatgttttgaaataggaaaaatcttcagcaaaggctctttgcggttaatattgt |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
49201453 |
agttcttacttctatttcacataccatgttttgaaataggaaaaaccttcagcaaaggctctttgcggttaatattgt |
49201376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8792 times since January 2019
Visitors: 8208