View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-16 (Length: 91)
Name: NF0440-3-1-Insertion-16
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-16 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7088479 - 7088389
Alignment:
Q |
1 |
ctttgttgaatagtgttgatctntcaaataatcattttagtggtaatgttgatttttctagtgtttggtcattgaataggcttagaagctt |
91 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
7088479 |
ctttgttgaatagtgttgatctttcaaataatcattttagtggtaatgttgatttttctagggtttggtcattgaataggcttagaagctt |
7088389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10286 times since January 2019
Visitors: 8439