View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-19 (Length: 105)
Name: NF0440-3-1-Insertion-19
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-19 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 40534114 - 40534218
Alignment:
Q |
1 |
gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40534114 |
gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc |
40534213 |
T |
|
Q |
101 |
aaatg |
105 |
Q |
|
|
||||| |
|
|
T |
40534214 |
aaatg |
40534218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13606 times since January 2019
Visitors: 8736