View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-25 (Length: 47)
Name: NF0440-3-1-Insertion-25
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-25 |
| |
|
[»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27970481 - 27970527
Alignment:
Q |
1 |
tttgagagcaaatgaagggtaatttaagtcccttgcaatcgcatatc |
47 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27970481 |
tttgagagcaaatgaagggtaatttaagtcccttgcagtcgcatatc |
27970527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7351 times since January 2019
Visitors: 6764