View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-26 (Length: 47)
Name: NF0440-3-1-Insertion-26
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-26 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 43410489 - 43410521
Alignment:
Q |
5 |
catctaatattaatatccaggactaccatcagc |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
43410489 |
catctaatattaatatccaggactaccatcagc |
43410521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4338 times since January 2019
Visitors: 6182