View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-38 (Length: 158)
Name: NF0440-3-1-Insertion-38
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-38 |
| |
|
[»] chr4 (3 HSPs) |
| |
|
[»] scaffold1330 (1 HSPs) |
| |
|
[»] scaffold0345 (1 HSPs) |
| |
|
[»] scaffold0105 (4 HSPs) |
| |
|
[»] scaffold0496 (1 HSPs) |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 2e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 6 - 158
Target Start/End: Original strand, 44919715 - 44919867
Alignment:
Q |
6 |
cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44919715 |
cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat |
44919814 |
T |
|
Q |
106 |
gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44919815 |
gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
44919867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 7411664 - 7411732
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| ||||||||| |
|
|
T |
7411664 |
atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt |
7411732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 91 - 158
Target Start/End: Original strand, 7457744 - 7457811
Alignment:
Q |
91 |
tgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
|||||||||| ||||||| ||| ||||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
T |
7457744 |
tgaatactccaagatgctcgttcggttcatccagccttggagaaattgcaatattagcaggtggttgt |
7457811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1330 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold1330
Description:
Target: scaffold1330; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 1394 - 1462
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
1394 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
1462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 3984 - 3916
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
3984 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
3916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 45; Significance: 6e-17; HSPs: 4)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 4097 - 4029
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
4097 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
4029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 10179 - 10111
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
10179 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
10111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #3
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 34995 - 35063
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
34995 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
35063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #4
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 48595 - 48663
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||||||||||||| |
|
|
T |
48595 |
atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt |
48663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0496 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0496
Description:
Target: scaffold0496; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 2592 - 2660
Alignment:
Q |
90 |
atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| ||||||||| |
|
|
T |
2592 |
atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt |
2660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 81 - 158
Target Start/End: Original strand, 24611194 - 24611271
Alignment:
Q |
81 |
ggaatgaaaatgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt |
158 |
Q |
|
|
||||||| |||||| ||| |||||||||||||||||||| |||||| |||| ||||| || |||| ||||||||| |
|
|
T |
24611194 |
ggaatgaggatgaattttccaagatgcttgtttggttctgctagcctcagagagattgcgattctagctggtggttgt |
24611271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1156 times since January 2019
Visitors: 8538