View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-41 (Length: 82)
Name: NF0440-3-1-Insertion-41
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-41 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 5e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 43342526 - 43342454
Alignment:
Q |
1 |
ccaacgaccaatagaagctaattcgaaatcaacttttttggccacctcttctacaggcttaagaatatcttct |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43342526 |
ccaacgaccaatagaagctaattcgaaatcaacttttttggccacctcttctacaggcttaagaatatcttct |
43342454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9253 times since January 2019
Visitors: 8342