View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-46 (Length: 69)
Name: NF0440-3-1-Insertion-46
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-46 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 3383932 - 3383870
Alignment:
Q |
3 |
gtggaagttggttttaggatggtgtgggttgtagagtcggtaatagtgaaagtatttcatttt |
65 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
T |
3383932 |
gtggaagttggttttaggatggtgtgggttgtagagtcggtaatggtgaaagtatttcctttt |
3383870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13949 times since January 2019
Visitors: 7618