View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-47 (Length: 92)
Name: NF0440-3-1-Insertion-47
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-47 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 9951325 - 9951415
Alignment:
Q |
2 |
cagaatgctctgttttgaaattatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacatgaatgaag |
92 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
9951325 |
cagaatgctctgttttgaaattatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacaagaatgaag |
9951415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 757 times since January 2019
Visitors: 6024