View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-49 (Length: 60)
Name: NF0440-3-1-Insertion-49
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-49 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 5e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 44729087 - 44729145
Alignment:
| Q |
2 |
attctttcatttccctagtgcacgagagaaattgataactacattctgtaaactatcat |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
44729087 |
attctttcatttccctagtgcacgagagagattgacaactacattctgtaaactatcat |
44729145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 12729398 - 12729433
Alignment:
| Q |
1 |
aattctttcatttccctagtgcacgagagaaattga |
36 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
12729398 |
aattctttcttttctctagtgcacgagagaaattga |
12729433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 24391843 - 24391903
Alignment:
| Q |
2 |
attctttcatttccctagtgcacgagagaaattg--ataactacattctgtaaactatcat |
60 |
Q |
| |
|
|||||||| |||| |||||||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
24391843 |
attctttcttttctctagtgcatgagagaaattgacataactttattctgtaaactatcat |
24391903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Complemental strand, 40574422 - 40574362
Alignment:
| Q |
2 |
attctttcatttccctagtgcacgagagaaattg--ataactacattctgtaaactatcat |
60 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
40574422 |
attctttcttttctctagtgcacgagagaaattgacagaactttattctgtaaactatcat |
40574362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3698 times since January 2019
Visitors: 8673