View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-51 (Length: 64)
Name: NF0440-3-1-Insertion-51
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-51 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 8e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 1215483 - 1215535
Alignment:
Q |
12 |
tgtttggctatttatatctgttaatgtatgcgcatatacgtgtatgcatgtat |
64 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
1215483 |
tgtttggctatttatatctgttaatgtatgcgcatatatgtgtatgcatgtat |
1215535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3003 times since January 2019
Visitors: 5923