View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-6 (Length: 123)
Name: NF0440-3-1-Insertion-6
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-6 |
| |
|
[»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 2e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 30 - 123
Target Start/End: Complemental strand, 42209764 - 42209671
Alignment:
Q |
30 |
tgtatgtatagctatctaatattgaggtgacatgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga |
123 |
Q |
|
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
T |
42209764 |
tgtatatatagctatctaatattggggtgacatgtttcagaatatggtttaggaggcaaggcttcaactagtggtgatgtgtacagttttggga |
42209671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 42222009 - 42221922
Alignment:
Q |
36 |
tatagctatctaatattgaggtgacatgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga |
123 |
Q |
|
|
||||||||||||||| || ||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
T |
42222009 |
tatagctatctaatactggggtaccatgtttcagaatatggtctaggaggcaaggcttcaactagtggtgatgtgtacagttttggga |
42221922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 61 - 123
Target Start/End: Complemental strand, 42191132 - 42191070
Alignment:
Q |
61 |
atgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42191132 |
atgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga |
42191070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 30129 times since January 2019
Visitors: 4089