View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-7 (Length: 102)
Name: NF0440-3-1-Insertion-7
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-7 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 39 - 102
Target Start/End: Complemental strand, 1806907 - 1806843
Alignment:
Q |
39 |
ttttatgtctccgcaatcatacttacagtaatatcaattgtatttaacctt-ttttgttgttgta |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
1806907 |
ttttatgtctccgcaatcatacttacagtaatatcaattgtatttaacctttttttgttgttgta |
1806843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10824 times since January 2019
Visitors: 4902