View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-8 (Length: 85)
Name: NF0440-3-1-Insertion-8
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 21146994 - 21146915
Alignment:
| Q |
7 |
attgacaga-aaattaaatccttgtcctattcaagttcccttgcatccagtttgccaacatctgaagtgcaacttttggt |
85 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21146994 |
attgacagataaattaaatacttgtcctattcaagttcccatgcatccagtttgccaacatctgaagtgcagcttttggt |
21146915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 21126866 - 21126821
Alignment:
| Q |
40 |
gttcccttgcatccagtttgccaacatctgaagtgcaacttttggt |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21126866 |
gttcccatgcatccagtttgccaacatctgaagtgcagcttttggt |
21126821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21472 times since January 2019
Visitors: 3055