View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-12 (Length: 163)
Name: NF0478-INSERTION-12
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0478-INSERTION-12 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 7e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 7e-63
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 3731371 - 3731210
Alignment:
Q |
1 |
cttaaatttttattgtagtagtttccctattgaagttgattaaagttcatctannnnnnnnnnnngcagactctaaataaactctttattattaatgctg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
3731371 |
cttaaatttttattgtagtagtttccctattgaagttgattaaagttcatctattttttttttt-gcagactctaaataaactctttattattaatgctg |
3731273 |
T |
|
Q |
101 |
gttctggctttaagatgttgtggaaagcagtgaaggcattcctaagtgaacgcacagtagcaa |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3731272 |
gttctggctttaagatgttgtggaaagcagtgaaggcattcctaagtgaacgcacagtagcaa |
3731210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12541 times since January 2019
Visitors: 8220