View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-4 (Length: 379)
Name: NF0478-INSERTION-4
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0478-INSERTION-4 |
| |
|
[»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 202 - 379
Target Start/End: Original strand, 21617359 - 21617536
Alignment:
Q |
202 |
ttgtgaatcagttttatttttatagacaaatgttactagtaaccaaagtggttaaaataactaaatttaaagatgaaattttcgaaagaatctgagttca |
301 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
21617359 |
ttgtgaatcagttttatttttatagacaaatgttactagtaaccaaagtggttaaaataactaaatttaaagatgaaatttttgaaagaatctgagttca |
21617458 |
T |
|
Q |
302 |
aatcttgattgaaacaatttttagttagcttttgtctacctacctccctcttgaattatagattattatataatactc |
379 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21617459 |
aatcttgattgaaacaatttttagttagcttttgtttacctacctccctcttgaattatagattattatataatactc |
21617536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 44 - 155
Target Start/End: Original strand, 21617190 - 21617301
Alignment:
Q |
44 |
aattgccaacatcttgggttaccccaaatctgtatgaacacttttccttctctctcttaagcctctctatttgcatgaatgtatgcataaattattcatt |
143 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
T |
21617190 |
aattgccaacatcttgggttaccccaaatctgtatgaacacttttccttctctctcttaagcctccctatttgcatgaatgtatgcataaattattgatt |
21617289 |
T |
|
Q |
144 |
aattttatggtc |
155 |
Q |
|
|
| |||||||||| |
|
|
T |
21617290 |
agttttatggtc |
21617301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13532 times since January 2019
Visitors: 8302