View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-7 (Length: 137)
Name: NF0478-INSERTION-7
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0478-INSERTION-7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 25802872 - 25802736
Alignment:
| Q |
1 |
gaaagtactttccaaccatccctattctgcaaatggagttgaataactttatattactagaccgacatttcataatggttggttcaatacttatttctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25802872 |
gaaagtactttccaaccatccctattctgcaaatggaggtgaataactttagattactagaccgacatttcataatggttggttcaatactcatttctca |
25802773 |
T |
|
| Q |
101 |
ggctttacaaaaatcagtgaacaaaacatgaggtagg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802772 |
ggctttacaaaaatcagtgaacaaaacatgaggtagg |
25802736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 2e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 53 - 117
Target Start/End: Complemental strand, 44346217 - 44346153
Alignment:
| Q |
53 |
attactagaccgacatttcataatggttggttcaatacttatttctcaggctttacaaaaatcag |
117 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44346217 |
attactagaccgccatttcaaaatggctggttcaatacttctttctcaggctttacaaaaatcag |
44346153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 2 - 51
Target Start/End: Complemental strand, 44346810 - 44346761
Alignment:
| Q |
2 |
aaagtactttccaaccatccctattctgcaaatggagttgaataacttta |
51 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
44346810 |
aaagtactttcaaaccatctcaattctgcaaatggaggtgaataacttta |
44346761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16536 times since January 2019
Visitors: 3768